INFORME PRELIMINAR SOBRE LAS INVESTIGACIONES DE LAS CAUSAS DE LA MUERTE DE EL LIBERTADOR SIMÓN BOLÍVAR

Comisión Presidencial para la Planificación y Activación del Proceso de Investigación Científica e Histórica, Sobre los Acontecimientos Relacionados con el Fallecimiento de El Libertador Simón Bolívar y el traslado a la Nación de sus restos mortales.

Caracas, julio de 2012

 

Conclusiones de Anatomía Patológica Forense en el estudio de los restos de El Libertador Simón Bolívar

Elaborado por:

Dra. Yanuacelis Cruz, Jefa de la División de Anatomía Patológica Forense de la Coordinación Nacional de Ciencias Forenses.

Dr. José Monque, Médico Anatomo Patólogo, ex Coordinador de Ciencias Forenses.

En el interior del sarcófago se aprecia un esqueleto humano del sexo masculino articulado y envuelto en una tela de Damasco de color pardo oscuro con flecos negros, los cuales se desprenden fácilmente. La tela presenta dos cortes lineales en su tercio medio izquierdo, producto de la apertura de la urna de plomo con la tijera. El tejido óseo se encuentra barnizado y en buen estado de conservación; dicho barniz se desprendió parcialmente con la manipulación. En las paredes laterales de la urna de plomo y a nivel de los pies se encuentran adosadas dos pequeñas urnas del mismo material que contienen en su interior polvo óseo, tierra, fragmento de camisa de color claro, restos de pelos, fragmentos de cuero y suela de botas. El cuero presenta un grabado repujado con la imagen de un triangulo isósceles cuyo vértice está orientado hacia la luz de un transportador.

En la pequeña urna lateral derecha también se encontró adosada al piso de la misma, otra caja de menor tamaño de forma achatada del mismo material, la cual contenía un papel doblado. Ésta fue entregada al ciudadano Vicepresidente de la República Bolivariana de Venezuela Elías Jaua. Posteriormente nos informaron que el escrito es el acta de la preparación del cadáver de S.E. El Libertador Simón Bolívar que realizó el Sabio Doctor José María Vargas en el año de 1843. Este fue entregado por el tribunal actuante al Ciudadano Ministro del Poder Popular para la Cultura Francisco Sesto.

El cadáver se encuentra en buen estado de conservación. Presenta restos blanquecinos de cloruro de cal y de barniz solidificado color neutro. Debido a la ausencia de algunos huesos en las manos y en los pies (falanges) se aprecia una reconstrucción, hecha en su oportunidad, con cera de moldear, la cual se solidificó, encontrándose frágil y quebradiza, faltando en áreas debido al paso del tiempo. El esqueleto fue unido con alambres, resortes, bisagras y una vara de plomo que articula la base del cráneo con todas las vértebras a través del agujero occipital y los agujeros vertebrales hasta el sacrocoxis. También se aprecia la unión y permanencia en sus sitios anatómicos de los arco costales y el esternón.

CRÁNEO Y CARA: Cráneo del sexo masculino muy bien conservado, sin lesiones traumáticas que describir. Normocefalo. Presenta un corte de sierra horizontal, limpio y preciso sobre la bóveda craneana, con escasa pérdida de tejido óseo. La calota craneal está articulada con el resto del cráneo por medio de cuatro pequeñas bisagras de bronce de color verde amarillento localizadas, dos en las regiones parieto temporales y dos en las regiones parieto occipitales. El maxilar inferior o mandíbula se encuentra desarticulado y fijado, a los huesos maxilar superior y a los parieto temporales derecho e izquierdo por resortes e hilos de bronce lábiles, quebradizos y deteriorados. Las piezas dentales están completas excepto por la ausencia de un molar izquierdo, tal como fué descrito por el Sabio Doctor José María Vargas. Son de color pardo, algunas de ellas con desgaste a nivel de la mordida. La cara presenta franca asimetría entre el lado derecho y el lado izquierdo. Se aprecia hundimiento del surco nasogeniano derecho, siendo el malar izquierdo más prominente. El hueso frontal es amplio. El espacio entre los agujeros nasales y la arcada dental es ancho. Los arcos superciliares son marcadamente prominentes. Hay gracilidad de los arcos cigomáticos en relación con el desarrollo de los huesos malares. Se evidencia perdida del tejido óseo por socavamiento postmorten de las paredes laterales y del piso de ambas órbitas. Pérdida total postmorten del cóndilo del maxilar inferior izquierdo y parcial del derecho. Ligero abultamiento del cráneo a nivel de las regiones parietooccipitales. Se evidencia asimetría del maxilar inferior por exostosis en tercio externo derecho a nivel de la unión de la rama horizontal con la vertical. Asimetría de los huesos propios de la nariz, coanas asimétricas, la derecha más descendida que la izquierda. Erosión postmorten de la apófisis mastoidea izquierda. Las apófisis estiloides son completas y fuertes.

Una vez realizado el estudio odontológico por parte de los expertos, se procede a la extracción de seis piezas dentales: Incisivo central superior izquierdo, incisivo lateral izquierdo, canino superior izquierdo, primer premolar superior izquierdo, incisivo central superior derecho, incisivo lateral derecho y canino superior derecho. De todos éstos se extrajo material de la pulpa dental para intentar identificar ADN. Posteriormente fueron regresados intactos a los alvéolos dentales correspondientes.

TORAX: Columna vertebral completa y articulada artificialmente con alambres, resortes y bisagras de bronce. A nivel de la base del cráneo se encuentra atornillada una vara de metal maleable de color gris que se fractura con facilidad y articula las vértebras de la columna desde el agujero occipital del cráneo a través de los agujeros vertebrales. Las vértebras cervicales, dorsales y lumbosacras están completas con los cambios degenerativos propios la edad (45 más o menos dos años) para el momento de la muerte. Se evidencia a nivel de la cuarta y quinta vertebra dorsales en sus carillas articulares un pequeño socavamiento, del cual se toman muestras para estudio histológico y reacción en cadena de la polimerasa para tratar de identificar ADN de microorganismos. Las tres últimas vértebras lumbares presentan signos de esclerosis por probable traumatismo crónico ocasionado por la monta a caballo. El resto de las vértebras sin lesiones aparentes. La parrilla costal está completa, parcialmente articulada de forma artificial por alambres y resortes. Presenta fracturas postmorten producto de la autopsia practicada por el Dr. Prospero Reverend. Para reconstruir los arcos costales tendrían que retirarse los alambres colocados por el Sabio Doctor José María Vargas y se acordó no modificarlos para preservar el esqueleto. Para reconstruir el tejido faltante por la toma de las muestras para los estudios especiales se utilizó material sintético (vidrio ionomérico) mezclado con polvo óseo.

ESTERNÓN: Presente. Cuerpo y manubrio articulados con alambres y bisagras. Se observa una variante anatómica del tercio medio/inferior que deja un orificio ovoide de 0,4 x 0,2 cm. CLAVÍCULAS: Sin evidencia de lesiones. ESCÁPULAS: Presentes (la derecha y la izquierda). Sin lesiones traumáticas que describir. Pérdida postmorten de sus cuerpos.

COLUMNA VERTEBRAL LUMBO SACRA: Las tres últimas vértebras lumbares presentan signos de esclerosis por probable traumatismo crónico ocasionado por la monta a caballo. El resto de las vértebras sin lesiones aparentes.

CONJUNTO PELVIANO: Completo. Presenta asimetría entre los dos huesos coxales. Fractura postmorten del borde superior de los mismos. El hueso coxal izquierdo está erosionado con marcada porosidad. En su cara anterior presenta excavamiento y erosión marcada. Se toman muestras para estudio histológico y de reacción en cadena de la polimerasa a fin de determinar ADN de agentes infecciosos. También se toman muestras del mismo tejido para realizar estudios toxicológicos con el fin de determinar la presencia y concentraciones de metales pesados. Se observan fijaciones metálicas en las ramas ileopuvianas y sacro coxígeas de la pelvis que la mantienen articulada.

HUESOS DE LAS EXTREMIDADES: Miembros superiores articulados con alambres y bisagras de metal. Discreta asimetría ya que el hueso humeral derecho presenta mayor robusticidad que el izquierdo, por lo que podemos suponer que se trata de una persona que era diestra. Huesos de las manos parcialmente desarticulados y ausentes con algunas falanges reconstruidas con cera de moldear que posteriormente se solidificó. Las extremidades inferiores se encuentran (fémur, tibia y peroné) articulados con alambres y bisagras de metal. Pérdida postmorten del tejido óseo del tercio superior de ambos perones. Huesos propios de los pies incompletos, algunos de ellos reconstruidos por cera para moldear que se solidificó con el tiempo.

Se toman dos cuñas de tejido óseo de la cabeza humeral derecha para estudio de ADN las cuales se envían al IVIC y a IDEA. Igualmente se toma una cuña de la cabeza de una falange de la mano izquierda para realizar estudio de ADN a solicitud de IDEA.

Todos los sitios de donde se tomaron las muestras fueron reconstruidos con un material moldeable, fotocurable de uso odontológico (vidrio ionomérico) de color hueso el cual se mezcló con polvo de tejido óseo del mismo cadáver con la finalidad de quedar reconstruido.

Es de hacer notar que todas las muestras fueron obtenidas utilizando los métodos más conservadoras posibles.

Se toma radiología simple del cráneo, tórax, columna vertebral, pelvis ósea, húmeros y fémures derecho e izquierdo.

Las muestras obtenidas del tejido óseo para determinar el ADN fueron tomadas antes de practicar los estudios radiológicos con el fin de evitar cualquier tipo de alteración en el ADN.

Se toma tomografía axial computarizada en un tomógrafo Siemens de 64 cortes para reconstrucción facial tridimensional.

ESTUDIO MICROSCÓPICO: Los cortes histológicos muestran tejido óseo conservado con presencia de escasas trabéculas lamelares y tejido fibroconectivo. También se realizaron coloraciones especiales para determinar la presencia de bacilos ácido-alcohol resistentes y hongos, las cuales fueron negativas.

 

Correlación Clinico-Patológica (Epicrisis)

Se practicaron estudios para la determinación por biología molecular de diferentes agentes microbiológicos patógenos, tales como Mycobacterium tuberculosis,Mycobacterium bovis, Treponema pallidum, Brucellas sp., Paracoccidioides brasiliensis, Plasmodium sp. Leishmania donovani y cutánea, siendo todos negativos.

Queda pendiente por realizar la investigación para determinar la posibilidad de una infección por Histoplasma capsulatum. Está proceso de elaboración el primer que permitirá comparar y determinar la existencia de ese patrón en la muestra de ADN antiguo. Este hongo es el causante de la histoplasmosis pulmonar crónica, donde se pueden encontrar adenomegalias y calcificaciones diseminadas en los pulmones, ganglios hiliares y el bazo. Esta enfermedad presenta síntomas y signos muy parecidos a los de la tuberculosis pulmonar crónica con cavitaciones. Es más común en hombres de mediana edad, ancianos y pacientes inmunodeficientes, evolucionando durante meses o años, con lapsos de inactividad y a veces curación espontánea; o conducir a la muerte si no es tratada adecuadamente.

Los análisis químicos practicados para la determinación de arsénico (As) no fueron concluyentes; aún cuando no hay evidencia clínica de intoxicación por este elemento, si es un hecho que los boletines emitidos por el médico tratante de El Libertador Dr. Alejandro Próspero Reverend, describen el tratamiento que recibió con medicamentos contentivos de arsénico.

La administración de polvo de cantárida, obtenido por medio de la desecación de un coleóptero perteneciente a la familia Cantáridas (especie Lytta vesicatoria) administrado a El Libertador en dosis elevadas y aplicado en forma de vejigatorios, es un veneno enérgico que produce vesículas en la piel, en el sitio de la administración y actúa sobre el sistema genitourinario. La intoxicación por cantaridina presenta los síntomas siguientes: disuria, polaquiuria y hematuria, alteraciones que van progresando hasta llegar a la anuria y por ende a la insuficiencia renal aguda, siendo éste el desencadenante final de la muerte de El Libertador.

Estas manifestaciones clínicas, agregadas a las de la enfermedad broncopulmonar crónica reagudizada, evidenciada por dificultad respiratoria, dolor torácico más intenso en el lado derecho, tos con expectoración mucopurulenta y fiebre, llevaron a El Libertador a una hipoxia marcada con disminución de la tensión de oxígeno y trastornos hidro-electrolíticos, la cual se manifiesta con más intensidad a nivel del encéfalo, trayendo como consecuencia trastornos de la conciencia, aumento de la permeabilidad capilar, salida de liquido del espacio intracelular e intravascular al espacio intersticial, con el consiguiente edema cerebral, que se acentúa a medida que aumenta la hipoxia, hasta llegar al enclavamiento de las amígdalas cerebelosas y compresión del bulbo raquídeo donde están ubicados el centro de la respiracion y del funcionamiento cardíaco, conduciendo a un paro cardio-respiratorio y por consiguiente la muerte.

 

Glosario de Terminología Médica del Informe de Anatomía Patológica

  • Disuria: ardor para orinar.
  • Polaquiuria: aumento de la frecuencia de la micción con escasa producción de orina.
  • Hematuria: Sangre en las orinas.
  • Anuria: ausencia de producción de Orinas.
  • Hipoxia: Disminución del Oxigeno que llega a el Sistema Nervioso central y a todos los órganos, siendo el primer Sistema afectado el Nervoso Central.
  • Micobacteryum Tuberculosis: agente productor de la tuberculosis, sea esta pulmonar o sistémica.
  • Micobacteryum Bovis: agente productor de tuberculosis en bovinos.
  • Treponema Pallidum sífilis: agente productor de la sífilis.
  • Brucillas sp.: agente productor de la enfermedad brucelosis (enfermedad respiratoria)
  • Paracoccidioides brasiliensis: agente productor de la enfermedad paracoccidioidomicosis.
  • Plasmodum sp.: agente productor de la enfermedad paludismo,
  • Leishmania donovani y cutánea: agentes productores de la Leshmaniasis.

 

 

Informe del Dr. Howard Takiff sobre las experticias realizadas en el Instituto Venezolano de Investigaciones Científicas (IVIC) para determinar las Causas de la Muerte de El Libertador, Simón Bolívar

Caracas, 19 de julio de 2012

Elaborado por:
Howard Takiff, Jefe del Laboratorio de Genética Molecular del IVIC.

En el laboratorio de la Unidad de Estudios Genéticos y Forenses (UEGF) del IVIC no se había realizado previamente una experticia que buscara evidencia de tuberculosis en huesos. Consulté como referencia artículos de otros investigadores que han encontrado evidencia de tuberculosis en huesos antiguos.

El trabajo fue realizado principalmente por los científicos Gerson Caraballo y Mary Acosta. Se aisló el DNA de una muestra de hueso y se utilizó la técnica de PCR para buscar DNA de una secuencia repetida en el cromosoma de la bacteria Micobacterium tuberculosis, agente causante de la tuberculosis.

No se encontraron resultados positivos: no se pudo encontrar evidencia de la presencia de ADN de M. tuberculosis.

Sin embargo, al ser esta la primera vez que en el IVIC se buscaba tuberculosis en huesos viejos, se quiso evitar que los resultados pudieran ser cuestionados, y que no pudieran ser tomados en cuenta como definitivos o contundentes.

Por ello, contacté a uno de los autores de los artículos de referencia consultados, que había encontrado evidencia de tuberculosis en otros huesos antiguos: el Dr. George Michael Taylor, actualmente en la Universidad de Surrey en Inglaterra. Recomendé a la Comisión Presidencial que le solicitara si pudiera realizar experticias a muestras de la osamenta que se le pudieran enviar.

Cumpliendo todos los procedimientos legales, el Dr. Taylor recibió de la Comisión Presidencial unos pequeños fragmentos de hueso. De ellos, aisló ADN para realizar la misma prueba que hicimos en el IVIC, y además utilizó otras técnicas más sofisticadas y sensibles. No encontró evidencia de tuberculosis, y tampoco evidencia de Malaria, ni evidencia de Paracoccidiosis brasiliensis, el hongo sugerido por el Dr. Paul Auwaerter como la posible causa de la afección pulmonar y de la muerte de El Libertador.

Dentro de la ciencia, la ausencia de evidencia no es un criterio 100% confiable de que la causa de la muerte no haya sido la tuberculosis, pero son los mejores resultados que hemos podido obtener hasta ahora. No hay que descartar que en 5 o 10 años existan mejores métodos científicos o tecnologías más sensibles que nos permitan tener resultados más certeros.

 

 

Informe sobre los análisis biomoleculares llevados a cabo sobre una muestra de los restos mortales del Libertador Simón Bolívar en la Universidad de Surrey, Guildford, Reino Unido.

 G.M. Taylor, División of Ciencias Microbiales, Facultad de Salud y Ciencias Médicas, Edificio AX, Stag Hill Campus, Guildford, Surrey, GU2 7TX, UK.

 

Objetivos:

Muestras tomadas de los restos de Simón Bolívar en el Panteón Nacional, después de la exhumación realizada en Caracas en julio de 2010, y transportadas al Reino Unido el 22 de agosto de 2011 por el Dr. Ángel L. Viloria (Instituto Venezolano de Investigaciones Científicas), fueron objeto de la presente investigación. Los exámenes realizados en la Universidad de Surrey se enfocaron en intentos para detectar ADN antiguo (aADN) indicativo de infección con bacterias del complejo Mycobacterium tuberculosis (MTB), y subsecuentemente en intentos para detectar otros patógenos, los cuales han sido objeto de especulación como causa de muerte del Libertador Simón Bolívar en 1830, a la edad de 47 años (Auwaerter et al, 2011).

 

Medidas tomadas para evitar contaminación.

Desde el comienzo de este estudio se tomaron medidas de seguridad para evitar contaminación del material traído al laboratorio con ADN moderno (reciente) o productos de PCR de experimentos anteriores. Se llevó a cabo una estrategia de tres laboratorios y cuatro estaciones de trabajo. Ésta consistió en la separación física de las etapas pre y post-PCR. La extracción del ADN y la preparación de la PCR fueron realizados en un laboratorio que no había sido utilizado previamente para trabajo con tuberculosis u otros patógenos bacterianos. La amplificación por PCR fue realizada en un laboratorio separado físicamente, cerrado, y localizado a distancia del “laboratorio limpio”, con fuente y extractores de aire separados. El análisis post-PCR, incluyendo electroforesis de geles, fue realizado en un tercer laboratorio preparado específicamente para este fin. Las áreas pre y post-PCR tenían distintos equipos, reactivos, material desechable y facilidades para guardar material en neveras y congeladores. Las medidas detalladas tomadas para evitar la contaminación han sido publicadas previamente (Taylor et al., 2006).

 

Extracción del ADN

Detalles de las muestras recibidas por el autor el 23 de agosto en la Sección Consular de la Embajada de la República Bolivariana de Venezuela en Londres, se muestran en la Tabla 1. Las muestras fueron abiertas en una campana de flujo categoría 2 dentro de las edificaciones de la División de Ciencias Microbianas de la Universidad de Surrey, Reino Unido. No se encontró ninguna muestra visible dentro el papel de aluminio en la placa de Petri (Muestra 005-D). Esta última supuestamente debía haber contenido dentina, cementum y pulpa extraídos del diente canino superior. La muestra fue devuelta a su bolsa. En su lugar, se realizaron extracciones de los materiales asociados con esta muestra: los cepillos y papeles absorbentes incluidos dentro de tubos cónicos de centrifugación de 15 ml. Esto se hizo junto con la extracción en las muestras 008-A y 008-D.

Los fragmentos de hueso de las muestras mencionadas fueron pulverizados en morteros estériles de cerámica y los polvos transferidos a tubos limpios de 15 ml. Se añadieron 9 ml de un buffer basado en Guanidino a cada uno de los tubos, los cuales entonces fueron procesados utilizando el estuche de extracción de ADN “NucliSensTM”, según las instrucciones del fabricante, pero con modificaciones menores (bioMérieux Ltd., Boxtel, Holanda). En este procedimiento, el buffer de lisis, suplementado con agitación vigorosa y tres ciclos de congelación – descongelación, fue utilizado para extraer fragmentos de ADN que estuvieren atrapados sobre las partículas de sílica en un proceso “batch”. Después de lavar la sílica con2 ml de buffer de lavado suministrado con el estuche (x2), se hizo un lavado con etanol 70% (2ml x 3) y acetona (2ml x 1). El residuo en la sílica fue eluído, secado al aire con 100 ml de agua grado HPLC, a 550 C, sobre un bloque caliente. Después de la centrifugación, los eluatos fueron almacenados a menos 200 C, hasta su posterior análisis.

 

Los ensayos de PCR aplicados.

Los estudios iniciales se enfocaron en la tuberculosis como una posible causa de muerte, según los reportes del post mortem realizado al cuerpo del Libertador Simón Bolívar por el médico francés Dr. Alexandre Prospere Révérend (Auwaerteret al., 2011). Los primeros PCRs aplicados fueron para la detección de la secuencia de inserción IS1081, presente en 6 copias en casi todas las especies y aislados del complejo micobacteriano de MTB. Dos versiones del ensayo fueron empleadas. El primero amplificó una región de 135 pb (pares de bases) y el segundo, un fragmento más pequeño de 79 pb, el cual ha demostrado ser útil en casos donde el ADN está extremadamente degradado. Una sonda dualmente marcada fue utilizada para monitorear la formación de producto en una plataforma de PCR en tiempo real (StratageneMxPro 3005P, Agilent Technologies). Los métodos con IS1081 son extremadamente sensibles y detectarían menos del equivalente a un solo genoma (Taylor et al., 2005).

Se utilizó un segundo blanco para buscar organismos del complejo MTB. Éste fue la secuencia de inserción IS6110 (Thierry et al., 1991), utilizada mucho en los primeros estudios de aADN y es un método que ha resistido la prueba del tiempo. Se utilizaron primers (cebadores) para un amplicon de 123 pb. Tanto el método del IS1081 como el de IS6110 detectarían los dos patógenos humanos más probables del complejo MTB,M. tuberculosis y M. bovis; así como las especies menos probables, como M. africanum, M. canetti, M. caprae, y M. microti etc. Adicionalmente, a los loci blancos dentro del complejo micobacteriano MTB, se emplearon métodos de PCR adicionales para probar los extractos de ADN como evidencia de otros patógenos, específicamente: paludismo, melodises, sífilis, brucelosis, leishmaniasis y paracoccidiomicosis. La Tabla 2 contiene la lista de las enfermedades probadas y el loci de blanco de PCR dentro los genomas patógenos.

 

Evidencia de la sobrevivencia de ADN humano en extractos de hueso.

Dos métodos de PCR fueron utilizados para buscar evidencia de ADN humano. Los extractos fueron probados utilizando primers que amplifican una región de 116 pb del ADN mitocondrial humano de la región hipervariable I (HVR-1). Las secuencias de los primers fueron:

Delantera (L15997) 5’-CCACCATTAGCACCCAAAGCTA-3’ y

Reversa (H16071) 5’- ATACATAGCGGTTGTTGATGGGT-3’

Las secuencias de los primers fueron modificadas levemente de aquellas recomendadas por el Dr. Carlos Álvarez, del Departamento de Medicina Forense de la Universidad de Granada, España. Se aplicó también un PCR para determinar género, basado en polimorfismos en el gen de amelogenina. En este método, los hombres se identifican por dos productos de PCR, uno de 105 pb del cromosoma Y, y otro de 290 pb del cromosoma X (Waldronet al., 1997).

 

Secuenciación de DNA.

Productos de la PCR del ADN mitrocondrial (mtADN) fueron separados en agarosa de bajo punto de fusión al 3% (peso/vol) (Invitrogen) y las bandas fueron cortadas con un bisturí estéril y purificadas con un dispositivo para aislar ADN GENECLEAN III (Fisher LifeSciences, UK). Las plantillas (templates) fueron secuenciadas empleando los primers delantero y reverso de BeckmanCoulterGenomics, Takeley, Essex, Reino Unido.

 

Resultados y Discusión

No se encontró evidencia de aADN del complejo de MTB en los extractos de hueso preparados de las muestras 008-A o 008-D empleando cualquiera de los dos marcadores de TB (IS1081 &IS6110), ni tampoco en los extractos preparados de 005-D (cepillos o tiras de papel) probado con el marcador IS1081 solo (Tabla 2). Las figuras 1a y 1b muestran los resultados de uno de los ensayos RT-PCR (PCR en tiempo real) empleando el elemento IS1081 para 135 y 79 pbamplicones, respectivamente. Los resultados del PCR con el elemento IS6110 aplicado a las muestras de hueso se muestran en la Figura 2. Todos fueron negativos. De igual manera, los extractos no mostraron evidencia de ADN remanente de otros posibles patógenos, algunos de los cuales han sido objeto de especulación en este caso (Auwaerteret al., 2011). Controles positivos para las PCRs de tuberculosis y Brucella, corridos después del trabajo con los extractos del Libertador Simón Bolívar, confirmaron que estos ensayos estuvieron funcionando como se esperaba (resultados no mostrados). Los primers para detectarParacoccidiomycosisbrasiliensis fueron diseñados específicamente para este estudio y no hubo control positivo disponible. Se ha demostrado previamente que los otros primers son capaces de detectar el ADN de los patógenos para los cuales han sido diseñados.

Para ayudar con la interpretación de estos hallazgos negativos, se intentó verificar la recuperación del ADN humano en las mismas muestras. Las dos muestras de hueso mostraron evidencia clara de la preservación de ADN mitocondrial (mtADN). La banda amplificada del mtADN de 116 pb del extracto del hueso del húmero (008-A, Tabla 3) fue purificada a partir de agarosa 3% y secuenciada con los primers delantero y reverso. Con los dos primers se obtuvo una secuencia de consenso. Esta secuencia no mostró ninguna desviación de la secuencia Anderson para la región HVR-1 (Andersonet al., 1981). La secuencia obtenida a partir de 008-A se muestra a continuación.

5’-CCACCATTAGCACCCAAAGCTAAGATTCTAATTTAA
ACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGG
TACCACCCAAGTATTGACTCACCCATCAACAACCGC
TATGTAT-3’.

Adicionalmente, como se demuestra en las Figuras 3a y 3b, la muestra de hueso tomada del húmero resultó positiva utilizando la PCR de amelogenina, mostrando sendas bandas para los cromosomas X y Y. Las otras muestras, incluyendo la de los extractos preparados de los cepillos y tiras de papel, resultaron negativas (Figura 4), y esto probablemente indica ADN humano menos preservado. La evaluación del ADN del huésped es útil en dos maneras. Primero, muestra que las condiciones favorecieron la sobrevivencia del ADN tanto en 008-A como en 008-D. También muestra que fragmentos de por lo menos 290 pb debían haber estado presentes en la muestra 008-A. En segundo lugar, bajo las condiciones del ensayo utilizado, la inhibición de la PCR no puede ser la explicación para el fallo en detectar DNA del complejo MTB o del otro patógeno.

Varias publicaciones sobre tuberculosis en la literatura arqueológica atestiguan sobre amplificación de ADN de micobacterias a partir de cuerpos ya enterrados, aún cuando la recuperación de ADN humano se ha encontrado comprometida. La naturaleza duradera de la pared micobacteriana (Takadeet al., 2003) ha sido propuesta para explicar esta observación (Donoghueet al., 2004) pero las razones exactas aun son desconocidas. El ADN del complejo MTB también puede encontrarse en restos humanos sin evidencia de lesiones del esqueleto (Faermanet al., 1997; Konomiet al., 2002; Mayset al., 2002; Zinket al., 2003; Donoghue, 2011).

Existe menos evidencia de sobrevivencia de aADN de otros patógenos buscados en el presente estudio. El ADN de plasmodium, parásito que causa el paludismo, se ha demostrado que sobrevive en esqueletos del SigloV en Italia (Sallares &Gomzi, 2001). Evidencia de brucelosis ha sido reportada en un individuo de la Edad de Hierro del Sur de Siberia (Taylor et al., 2007; Donoghue, 2008), y más recientemente en restos humanos fechados en los siglos XI-XIII y excavados del sitio de Butrint en Albania (Mutoloet al., 2011). A pesar de reportes tempranos sobre la factibilidad de amplificar ADN de treponema (agente causante de sífilis) de casos históricos de sífilis (Kolmanet al., 1999), la experiencia de la mayoría de los investigadores de aADN ha sido que el ADN de este patógeno no persiste o no es apto para identificar casos de expedientes arqueológicos (Bouwman&Brown, 2004). Es posible que se deba a que el patógeno ya está ausente o presente en pequeño número cuando las lesiones distintivas del esqueleto son aparentes y por ende hacen que los restos llamen la atención.

Zink y colegas (2003) han amplificado ADN de Leishmania a partir de restos enterrados tanto de Egipto como de Nubiade hace aproximadamente 4000 años. El mismo blanco de kinetoplástido fue escogido para el estudio presente y con sólo unas modificaciones menores en los primers oligonucleotídicos. No existe evidencia sobre la recuperación de ADN a partir de Burkholderiapseudomalleio P. brasiliensisprovenientes de fuentes arqueológicas, para evaluar la factibilidad de estudios de aADN sobre estos patógenos.

 

Conclusiones.

No se encontró ninguna evidencia de la presencia de ADN del complejo MTB en el material disponible para estudio. Se pudiera argumentar que los fragmentos óseos tomados del húmero e ileo no son los más apropiados para proveer evidencia de la tuberculosis pulmonar. Esto constituye una posible explicación para los hallazgos negativos. Sin embargo, nosotros y otros investigadores hemos encontrado la presencia de ADN del complejo MTB en componentes del esqueleto en casos donde la tuberculosis pulmonar era probable. Lo mismo es cierto también para el ADN de la otra micobacteria, Mycobacterium leprae, que se puede detectar a cierta distancia de las lesiones del esqueleto en casos de la lepra lepromatosa. La sobrevivencia de ADN humano y la falta de inhibición del PCR indican que estas muestras se encontraban aptas para estudios de aDNA. En vista de las PCRs altamente sensibles y los blancos multi-copias que se utilizaron, es probable que cualquier ADN remanente del complejo MTB existente en nuestras muestras se hubiera podido detectar. Aunque no se puede excluir la tuberculosis como causa de muerte, parece ahora una causa menos probable que lo que se había concluido previamente en los informes del examen post mortemrealizado en 1830.

 

Bibliografía

Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R, Young IG. Sequence and organization of the human mitochondrial genome.Nature290(5806): 457-465, 1981.

Auwaerter PG, Dove J, Mackowiak PA. Simon Bolivar’s Medical Labyrinth: An Infectious Diseases Conundrum. Clinical Infectious Diseases52(1): 78–85, 2011.

Bouwman AS, Brown TA. The limits of biomolecularpalaeopathology: ancient DNA cannot be used to study venereal syphilis. Journal of Archaeological Science32: 703-713, 2005.

Donoghue HD, Spigelman M, Greenblatt CL, Lev-Maor G, Bar-Gal GK, Matheson C, Vernon K, Nerlich AG, Zink AR. Tuberculosis: from prehistory to Robert Koch, as revealed by ancient DNA. Lancet Infectious Diseases4: 584-592, 2004.

Donogue HD. Molecular palaeopathology of human infectious diseases.Chapter 8 in“Advances in Human Palaeopathology” pp 147-176. Editors Ron Pinhasi and Simon Mays John Wiley & Sons Ltd., Chichester, West Sussex, UK, 2008.

Donoghue HD. Insights gained from palaeomicrobiology into ancient and modern tuberculosis. Clinical and Microbiological Infection17: 821-829, 2011.

Faerman M, Jankauskas R, Gorski A, Bercovier H, Greenblatt CL. Prevalence of human tuberculosis in a medieval population of Lithuania studied by ancient DNA analysis.Ancient Biomolecules1: 205–214, 1997.

Kolman CJ, Centurion-Lara A, Lukehart SA, Owsley DW, Tuross N. Identification of Treponemapallidum subspecies pallidum in a 200-year-old skeletal specimen. Journal of Infectious Diseases 180:2060-2063,1999.

Konomi N, Lebwohl E, Mowbray K, Tattersall I, Zhang D. Detection of mycobacterial DNA in Andean mummies. Journal of Clinical Microbiology40: 4738–4740, 2002.

Mays S, Fysh E, Taylor GM. Periostitic rib lesions – a sign of pulmonary tuberculosis?American Journal of Physical Anthropology, 119: 27-36, 2002.

Mutolo MJ, Jenny LL, Fenton TW, Foran DR. Osteological and Molecular Identification of Brucellosis in Ancient Butrint, Albania.American Journal of Physical Anthropology, 2011 in press.

Sallares R, Gomzi S. Biomolecular archaeology of malaria.Amcient Biomolecules 3:195-213, 2001.

Supaprom C, Wang D, Leelayuwat C, Thaewpia W, Susaengrat W, Koh V, EngEongOoi EE,

Lertmemongkolchai G, Liu Y. Development of real-time PCR assays and evaluation of their potential use for rapid detection of Burkholderiapseudomalleiin clinical blood specimens. Journal of Clinical Microbiology45: 2894-2901, 2007.

Takade A, Umeda A, Matsuoka M, Yoshida S-I, Nakamura M, Amako K: Comparative studies on the cell structures of Mycobacterium lepraeand M. tuberculosis using the electron microscopy freeze-substitution technique. Microbiology and Immunology 47: 265-270, 2003.

Taylor GM, Worth DR, Palmer S, Jahans K, Hewinson RG.Rapid Detection ofMycobacterium bovis DNA in cattle lymph nodes with visible lesions using PCR.BMC Veterinary Research 3:12, 2007.

Taylor GM, Watson CL, Lockwood DNJ, Mays SA. Variable nucleotide tandem repeat (vntr) typing of two cases of lepromatous leprosy from the archaeological record.Journal of Archaeological Science33: 1569-1579, 2006.

Taylor GM, Murphy E, Hopkins R, RutlandPC, Chistov Y.First report of Mycobacterium bovis DNA in archaeological human remains.Microbiology153: 1243-1249, 2007.

Thierry D, Cave MD, Eisenach KD, Crawford JT, Bates JH, Gicquel B, Guesdon JL.1S6110, an IS-like element of Mycobacterium tuberculosis complex.Nucleic Acids Research,18: 1990

Waldron, HA, Taylor GM, Rudling, DR. Sexing of Romano-British baby burials from the Beddingham Roman villa, East Sussex.Sussex Archaeological Collections, 137: 71-79, 1999.

Zink AR, Grabner W, Reischl U, Wolf H, Nerlich AG. Molecular study on human tuberculosis in three geographically distinct and time delineated populations from ancient Egypt.Epidemiology and Infection130: 239–249, 2003.

Traducido por Angel Viloria y Howard Takiff.

 

Tablas

Tabla 1. Muestras de los restos del LibertadorSimón Bolívar examinado en el presenteestudio.

No.Muestra BolsaSellada No. Descripción Commentarios
008-A 00367649 Fragmentode la cabezadelhúmero Dentro de un tubocónico de 15ml de centrifugación
008-D 00367694 Fragmentode iliac crest Como arriba
005-D 00367617 Cementumy dentinadel interior del canino central superior Paquete de papelaluminio en unaplaca Petri (roto) y encerrado en películaplástica.Aparecevacío
005-D Como arriba 6 pequeñocepillos Dentro de un tubocónical de centrifugación de 15ml
005-D Como arriba 5 tiritas de papelabsorbente Dentro de tubosseparadoscónicosde centrifugación de 15ml

 

Tabla 2. Métodos de PCR de patógenosutilizadospara examiner muestras de hueso de SB.

Patógeno Enfermedad Método Amplicon size (bp) PCR tipo Ciclos Reportero
MTB complejo Tuberculosis IS1081 135 RT-PCR 41 Sonda
MTB complejo Tuberculosis IS1081 79 RT-PCR 41 Sonda
MTB complejo Tuberculosis IS6110 123 cPCR 41 Agarosagel
Brucella spp. Brucellosis IS711 108 RT-PCR 41 EVA Verde
Treponemapallidum Sífilis 15-KDalipoptoteínagen 120 RT-PCR 41 EVA Verde
P.brasiliensis Paracoccidioidomycosis Gp43 118 RT-PCR 41 EVA Verde
Burkholderia pseudomallei Melioidosis Cromosoma 2 81 RT-PCR1 41 EVA Verde / sonda
Leishmania major Leishmaniasis Minicircculo kinetoplast 116 RT-PCR 41 EVA Verde
Falciparum spp. Malaria 18S rRNAgen 135-138 RT-PCR 41 EVA Verde

cPCR = conventional PCR; RT-PCR = PCR en tiempo real; 1Supaprom et al, 2007.

 

Tabla3. Resultados de PCR de las investigaciones para patógenos y aDNA humano.

Muestra DNA Humano Tuberculosis Para coccidio mycosis Malaria Melioi dosis Sífi lis Leish mania Bruce llosis
Mt DNA Amelo genin IS1081(135) IS1081(113) IS6110 18SrRNA 15-KDa IS711
008-A ++ + M - - - - - - - - -
008-D + - - - - - - - - - -
005-D Cepillos - - - - nd nd nd nd Nd nd nd
005-D tiritas de papel - - - - nd nd nd nd Nd nd nd

 

Figuras

Figura1a. Gráfica de la amplificación de PCR en tiempo-real del ensayo IS1081 (135 pb) aplicado a muestras 008-A y 008-D.

 

Figura 1b.Gráfica de la amplificación de PCR en tiempo-real del ensayo IS1081 (79 pb) aplicado a muestras 008-A y 008-D.

 

Figura 2. IS6110cPCR (123 pb) aplicada a muestras 008-A y 008-D. Canal 1 = 50 pb DNA escalera Canales 2 & 3 = muestra 008-D. Canales 6 & 7 = controles con agua.

 

Figura 3a. Perfil de amplificación de amelogeninapor PCR de muestras de SB 008-A, 008-D, y 005-A.Solo 008-A muestraalgúnproducto de amplificación.

 

Figura 3b. Perfíl de disociación de PCR de amelogenin (curva de derretimiento). La únicamuestrapositivaes SB 008-A.

 

Figura 4. Productos de PCR de amelogeninaanalizados en un gel de 3% agarosa.
Canal 1 = marcadores de tamaño de DNA.
Canal 2 = muestra 008-A. Estagenero dos productos de 290 y 105 pb los cualesindican el generomasculino.
Canal 3 = 008-D.
Canal 4 = 005-D (cepillos).
Canal 5 = 005-D (tiritas de papel).
Canal 6 = NTC ( control sin templado).

INFORME SOBRE LA RECONSTRUCCIÓN FACIAL 3D DE EL LIBERTADOR SIMÓN BOLÍVAR

Comisión Presidencial para la Planificación y Activación del Proceso de Investigación Científica e Histórica, Sobre los Acontecimientos Relacionados con el Fallecimiento de El Libertador Simón Bolívar y el traslado a la Nación de sus restos mortales.

Caracas, julio de 2012

 

Pasos de la Reconstrucción Facial:

  1. Reconstrucción y Digitalización Tridimensional del Cráneo.
  2. Establecimiento de la Profundidad de los Grosores del tejido Blando.
  3. Modelado de la musculatura facial por medio de gráficos computarizados tridimensional.
  4. Asignación de los detalles del Rostro como son el tono de piel, color de ojos, forma, color del cabello, cejas, pilosidad facial, arrugas faciales y sombreado para dar una apariencia natural, y el deterioro sufrido por los últimos meses de su enfermedad, todo lo cual dará forma grafica a los informes científicos forenses.

 

Requerimientos para la Reconstrucción facial:

Cada una de las especialidades científicas (radiología forense, medicina forense, odontología forense, antropología forense y antomopatología forense) debe participar en la elaboración del rostro, y se debe contar con:

  • Imágenes "DICOM". Con una definición de 0,6mm.
  • Los algoritmos del desgaste óseo producto de las enfermedades, los cuales son aportados por el análisis anatomo-patológico realizado posterior a la exhumación.
  • Los parámetros ontogénicos y diámetros de la región facial, dado del estudio Antropológico,
  • Facetas de desgaste, las alturas del esmalte, Prominencia de los caninos, mordida en oclusión céntrica.

 

Descripción del procedimiento para hacer la Reconstrucción Facial:

El trabajo realizado no se basa en ningún automatismo informático, en el Laboratorio de Visual Forensic, en Barcelona, España, se posicionaron las imágenes obtenidas de la tomografía.

Los tejidos blandos y marcadores de espesores se añaden manualmente dentro de un software 3D de marca Alemana (Maxon) que se llama "Cinema4d".

Es un software generalista 3D que no está especializado en reconstrucción facial pero que permite alcanzar un nivel de acabado muy realista permitiendo así respetar la imagen de la persona cuyo rostro se quiere reconstruir.

Los detalles de acabado son esculpidos a mano dentro de otro software llamado "Zbrush" y que permite manejar las topografías creadas como si fuesen "arcilla digital".

Todo este trabajo se apoya en tablas de espesores de tejidos blandos que corresponden a un segmento de población (edad/origen étnico/dieta determinada).

Es muy importante que las tablas estén hechas a partir de sujetos vivos, para que no se alteren los volúmenes de fluidos corporales. Todos esos elementos se añaden sobre la base de datos de la tomografía TAc.

Se tomaron fotos a hombres venezolanos, de entre 40 y 45 años, y se enviaron como referencia. Posteriormente se enviaron también fotografías d hombres venezolanos de esas edades pero que padecieran afecciones respiratorias. Estas servirían para tener referencias de la piel.

Para recrear el uniforme, se tomaron fotografías de las prendas que El Libertador usara en vida, que estaban siendo restauradas en el Centro Nacional de Conservación y Restauración, ente adscrito al Ministerio del Poder Popular para la Cultura. Específicamente se tomaron fotografías de:

  1. fotos de detalles del cuello y de los bordados con son hilos de oro y esquemas de los bordados
  2. fotos de los botones, ribetes, costuras.
  3. fotos de detalle de las telas originales
  4. fotos de detalles de las charreteras originales

Como referencia para el cabello, se utilizaron los retratos pintados en vida de El Libertador por el artista peruano, José Gil de Castro, uno de ellos, se encuentra en el Salón Elíptico de la Asamblea Nacional.

 

Imágenes finales:

Las bases de datos se calculan en "Full HD" y 300 pix/p lo que alarga el tiempo de producción pero permite obtener una alta calidad de reconstrucción.

La reconstrucción facial una vez acabada se puede transformar en modelos "físicos", es a decir, en escultura real, derivadas de la topografía 3D.

También se podrían crear imágenes estereoscópicas del rostro que serán visibles mediante gafas específicas.

 

Otras reconstrucciones faciales que se han hecho:

  • "Blanca d'Anjou" (Siglo XIII).
  • Rey Pedro III de Aragón (1276 - 1285), reconstituido a partir del TAC del cráneo y realizada para el Museù d'Historia del Gobierno de Catalunya de Barcelona.
  • Nicolás Copérnico.
  • Faraón egipcio Tutankamón.



Retrato de El Libetador Simón Bolívar

Retrato de El Libertador Simón Bolívar pintando en 1825 por el artista peruano José Gil de Castro (usado como referencia)

 

Reconstrucción facial 3D de El Libertador

Reconstrucción facial 3D de El Libertador Simón Bolívar. Vista Frontal.

 

Reconstrucción facial 3D de El Libertador

Reconstrucción facial 3D de El Libertador Simón Bolívar. Vista Perfil 1.

 

Reconstrucción facial 3D de El Libertador

Reconstrucción facial 3D de El Libertador Simón Bolívar. Vista Perfil 2.

Cronología de Simón Bolívar

Fuente: http://timerime.com/

1783 Nacimiento, en Caracas el 24 de Julio.
1786 Fallece su padre el 19 de Enero.
1792 Fallece su madre el 6 de Julio.
1798 Es nombrado Sub-Teniente.
1799 Viaja a España.
1802 Se casa el 26 de Mayo con María Teresa del Toro y Alaiza.
1802 Regresa a Venezuela.
1803 Enviuda el 22 de Enero.
1803 Viaja a España el 23 de Octubre.
1804 Presencia, en París, la Coronación de Napoleón.
1805 Hace el Juramento del Monte Sacro, en Roma el 15 de Agosto.
1805 Regresa a París en Diciembre.
1806 Regresa a Venezuela, pasando por los Estados Unidos.
1810 En misión diplomática sale hacia Londres, a nombre de la Junta de Gobierno de Venezuela el 6 de Junio.
1810 Regresa a Caracas el 5 de Diciembre.
1811 Pronuncia un discurso en la Sociedad Patriótica el 4 de julio.
1811 Interviene en la toma de Valencia.
1812 Se encarga del mando de Puerto Cabello.
1812 Abandona Puerto Cabello.
1812 Apresa a Miranda el 30 de julio.
1812 Se embarca para Curazao.
1812 Llega a Cartagena el 27 de Diciembre
1813 Inicia por su cuenta la "CAMPAÑA ADMIRABLE".
1813 Triunfa en Cúcuta el 28 de Febrero.
1813 Lo aclaman Libertador, en Mérida el 23 de Mayo.
1813 Decreta la "GUERRA A MUERTE" en Trujillo el 15 de Junio.
1813 Triunfa en Taguanes el 31 de Julio.
1813 Entra en Caracas el 7 de Agosto.
1813 Triunfa en Bárbula el 30 de Septiembre.
1813 La Municipalidad de Caracas le aclama Capitán General de los Ejércitos de Venezuela y le da el nombre de "LIBERTADOR".
1813 Es derrotado en Barquisimeto, pero triunfa en Vigrima y Araure.
1814 Interviene en intensas batallas en San Mateo en Febrero y Marzo.
1814 Interviene en la liberación de Valencia, el 3 de Abril.
1814 Primer triunfo en Carabobo.
1814 Es derrotado en la Puerta el 15 de junio.
1814 Dirige la emigración en masa hacia el oriente de Venezuela.
1814 Es derrotado en Villa de Aragua de Barcelona.
1814 Abandona el país, por Carúpano, rumbo a Cartagena el 8 de Septiembre.
1814 Se presenta en Tunja al Congreso de la Nueva Granada el 24 de Noviembre.
1814 Toma de Bogotá.
1814 Asedio de Cartagena el 24 de Marzo.
1815 Abandona el país rumbo a Jamaica.
1815 Escribe la célebre "CARTA DE JAMAICA". Intentan asesinarle.
1815 Desembarca en los Cayos de San Luis y conferencia con el Presidente de Haití, Alejandro Petión.
1816 Sale con una expedición Libertadora, rumbo a la isla venezolana de Margarita el 21 de Marzo.
1816 Triunfo naval en los Frailes.
1816 Desembarca en Margarita el 2 de Mayo.
1816 Toma de Carúpano en la costa Venezolana.
1816 Desembarca en Ocumare de la Costa el 6 de Julio.
1816 Es derrotado en los Aguacates.
1816 Reembarque en Ocumare y desembarque en Güiria.
1816 Reembarque hacia los Cayos (Haití) el 22 de Agosto.
1816 Segunda expedición Libertadora, rumbo a Margarita el 21 de Diciembre.
1816 Llega a Margarita.
1816 Desembarco en Barcelona el 31 de Diciembre.
1817 Combates en Clarines y Barcelona.
1817 Arribo al río Orinoco el 3 de Abril.
1817 Toma de Angostura el 17 de Julio.
1817 Aclamado jefe Supremo el 24 de Julio.
1817 Fusilamiento del General Piar el 16 de Octubre.
1817 Creación del Consejo de Estado.
1817 Apertura de la campaña del Guárico el 31 de Diciembre.
1818 Sorpresa de Calabozo y combate en el Sombrero.
1818 Segunda derrota en la Puerta.
1818 Derrota en Ortíz el 26 de Marzo.
1818 Sorpresa y peligro de muerte en el Rincón de los Toros.
1818 Regreso a Angostura.
1818 Convocatoria del Congreso de Venezuela.
1819 Instalación del Congreso en Angostura el 15 de Febrero.
1819 Apertura de la campaña, rumbo a Nueva Granada el 27 de Febrero.
1819 Paso de los Andes por el Páramo de Pisba el 5 de julio.
1819 Victoria en el Pantano de Vargas el 25 de julio.
1819 Triunfo en Boyacá el 7 de Agosto.
1819 Liberación de Bogotá el 10 de Agosto.
1819 Llegada a Angostura el 11 de Diciembre.
1819 Creación de Colombia en el Congreso de Angostura. Es elegido Presidente el 17 de Diciembre.
1819 Sale de Angostura, rumbo a la Nueva Granada el 24 de Diciembre.
1820 Entra en Bogotá el 5 de Marzo.
1820 Sale de Bogotá, rumbo a Venezuela el 22 de Marzo.
1820 Residencia de 4 meses en la frontera con Venezuela, Abril - Agosto.
1820 Llega a Turbaco, para el asedio de Cartagena.
1820 Retorna a la frontera el 21 de Septiembre.
1820 Apertura de la campaña de Venezuela el 27 de Septiembre.
1820 Tratado de armisticio el 26 de Noviembre
1820 Triunfo diplomático sobre el General Morillo en la entrevista de Santa Ana el 27 de Noviembre.
1820 Retorno a la frontera.
1821 Regresa a Bogotá el 10 de Enero.
1821 Apertura de la nueva campaña de Venezuela el 1 de Marzo.
1821 Triunfo en la segunda batalla de Carabobo el 24 de Junio.
1821 Entra en Caracas el 29 de Junio.
1821 Ofrece ejércitos para la liberación del Perú.
1821 Asiste al Congreso del Rosario de Cúcuta, que le da facultades extraordinarias el 29 de Septiembre.
1821 Parte para la campaña del Sur.
1822 Triunfo en Bomboná el 7 de Abril.
1822 Victoria en Pichincha (éxito de Sucre) el 24 de Mayo.
1822 Capitulación de Pasto.
1822 Llega a Quito, conoce a Manuela Sáenz el 16 de junio.
1822 Llega a Guayaquil. Esta provincia se incorpora a Colombia el 13 de julio.
1822 Triunfo diplomático en la conferencia, en Guayaquil, con el General San Martín el 26 y 2 7 de Julio
1823 Bolívar, en Pasto el 3 de Enero.
1823 Llega a Guayaquil y envía una expedición de seis mil hombres al Perú en Marzo-Abril.
1823 Llega a Lima el 2 de Septiembre.
1823 Marcha a someter a Riva Aguero.
1824 El Congreso del Perú le nombra Dictador el 1 de Febrero.
1824 Peligro de muerte en Pativilca en Marzo.
1824 Apertura de la campaña del Peru. Atraviesa la cordillera de los Andes en junio.
1824 Triunfo en Junín el 6 de Agosto.
1824 Liberación de Lima en Noviembre.
1824 Invitación para el Congreso Interamericano de Panamá el 7 de Diciembre.
1824 Victoria en Ayacucho (éxito de Sucre) el 9 de Diciembre.
1825 Reunión del Congreso Peruano en Lima el cual Decretó Honores y Recompensas Pecunarias para Bolívar en Febrero.
1825 Visita a los Departamentos del Sur del Perú en Abril.
1825 Creación de Bolivia el 16 de Mayo.
1825 Llega a Cuzco el 25 de junio.
1825 Conferencia en Potosí, con enviados especiales del Río de La Plata.
1825 Llega a Lima y da a conocer su proyecto de Constitución para Bolivia de Febrero a Mayo.
1826 Se instala el Congreso de Panamá el 22 de junio.
1826 Bolívar. Declarado Presidente vitalicio del Perú y adopción de la Constitución Boliviana de Agosto a Septiembre.
1826 Llega a Guayaquil el 12 de Septiembre.
1826 Entra en Bogotá el 14 de Noviembre.
1826 Parte para Venezuela el 25 de Noviembre.
1827 Llega a Caracas el 12 de Enero.
1827 Llega a Cartagena el 9 de julio.
1827 Llega a Bogotá el 10 de Septiembre.
1828 Llega a Bucaramanga donde permanece mientras se celebra la Convención de Ocaña.
1828 Dictador de Colombia el 13 de Junio.
1828 Llega a Bogotá y convoca a elecciones para Enero de 1930 el 24 de junio.
1828 Intento de asesinato el 25 de Septiembre.
1828 Parte para el Sur a hacer frente a la invasión de tropas peruanas el 28 de Diciembre.
1829 Llega a Quito el 18 de marzo.
1829 Armisticio con el Perú el 27 de Junio.
1829 Enfermo de gravedad en Guayaquil en Agosto.
1829 Tratado de paz con el Perú el 22 de Septiembre.
1830 Llega a Bogotá el 15 de Enero.
1830 Instalación del Congreso el 20 de Enero.
1830 Renuncia al poder el 27 de Abril.
1830 Entrega el poder al Vicepresidente.
1830 Parte para Cartagena el 8 de Mayo.
1830 Recibe en Cartagena la noticia del asesinato de Sucre el 1 de Julio.
1830 Llega a Santa Marta el 1 de Diciembre.
1830 Llega a la Quinta de San Pedro Alejandrino.
1830 Muerte el 17 de Diciembre.